Mature sequence mmu-miR-3471

Accession numberMIMAT0015642
IDmmu-miR-3471
Stem-Loop mmu-mir-3471-1 mmu-mir-3471-2
Sequence
ugagauccaacuguaaggcauu
Get sequence
Deep sequencing15731 reads, 72 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).