Mature sequence mmu-miR-3470b

Accession numberMIMAT0015641
IDmmu-miR-3470b
Stem-Loop mmu-mir-3470b
Sequence
ucacucuguagaccaggcugg
Get sequence
Deep sequencing270086 reads, 133 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).