Mature sequence mmu-miR-3470a

Accession numberMIMAT0015640
IDmmu-miR-3470a
Stem-Loop mmu-mir-3470a
Sequence
ucacuuuguagaccaggcugg
Get sequence
Deep sequencing214162 reads, 120 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).