Mature sequence bmo-miR-3421

Accession numberMIMAT0015629
IDbmo-miR-3421
Stem-Loop bmo-mir-3421
Sequence
ucaaacgaauuaaaucagaggucu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).