Mature sequence bmo-miR-3384-5p

Accession numberMIMAT0015579
IDbmo-miR-3384-5p
Previous IDsbmo-miR-3384*
Stem-Loop bmo-mir-3384
Sequence
ugaaauguguccucuauccggcuc
Get sequence
Deep sequencing18 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).