Mature sequence bmo-miR-3338-5p

Accession numberMIMAT0015525
IDbmo-miR-3338-5p
Previous IDsbmo-miR-3338*
Sequence
agcaaacacaguagugugcaa
Get sequence
Stem-Loop bmo-mir-3338

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).