Mature sequence bmo-miR-3286-5p

Accession numberMIMAT0015472
IDbmo-miR-3286-5p
Previous IDsbmo-miR-3286*
Sequence
aacuauuggucacugcacaggaa
Get sequence
Stem-Loop bmo-mir-3286

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).