Mature sequence hsa-miR-3065-3p

Accession numberMIMAT0015378
IDhsa-miR-3065-3p
Stem-Loop hsa-mir-3065
Sequence
ucagcaccaggauauuguuggag
Get sequence
Deep sequencing5439 reads, 95 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).
3
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).