Mature sequence zma-miR395o-5p

Accession numberMIMAT0015347
IDzma-miR395o-5p
Previous IDszma-miR395o*
Stem-Loop zma-MIR395o
Sequence
guucucuucaagcacuucacga
Get sequence
Deep sequencing8 reads, 4 experiments

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).