Mature sequence zma-miR395f-5p

Accession numberMIMAT0015338
IDzma-miR395f-5p
Previous IDszma-miR395f*
Stem-Loop zma-MIR395f
Sequence
guuaccuacaagcacgucucga
Get sequence
Deep sequencing24 reads, 7 experiments

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).