Mature sequence zma-miR156l-3p

Accession numberMIMAT0015308
IDzma-miR156l-3p
Previous IDszma-miR156l*
Stem-Loop zma-MIR156l
Sequence
gcucacugcucuaucugucacc
Get sequence
Deep sequencing146 reads, 14 experiments
Database links
QuickGO function

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).