Mature sequence bmo-miR-2843-2-3p

Accession numberMIMAT0015307
IDbmo-miR-2843-2-3p
Previous IDsbmo-miR-2843-2*
Stem-Loop bmo-mir-2843-2
Sequence
uucgugaucaagccugaccccuuaau
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).