Mature sequence bmo-miR-993b-5p

Accession numberMIMAT0015297
IDbmo-miR-993b-5p
Previous IDsbmo-miR-993b*
Stem-Loop bmo-mir-993b
Sequence
uacccuguagauccgggcuuucg
Get sequence
Deep sequencing450 reads, 3 experiments
Database links
QuickGO function

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).