Mature sequence osa-miR1320-3p

Accession numberMIMAT0015286
IDosa-miR1320-3p
Stem-Loop osa-MIR1320
Sequence
uguaaaauucauucguuccaa
Get sequence
Deep sequencing19 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:18323537 "Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa" Morin RD, Aksay G, Dolgosheina E, Ebhardt HA, Magrini V, Mardis ER, Sahinalp SC, Unrau PJ Genome Res. 18:571-584(2008).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).