Mature sequence cin-miR-219-3p

Accession numberMIMAT0015264
IDcin-miR-219-3p
Previous IDscin-miR-219*
Stem-Loop cin-mir-219
Sequence
gcgauugugucuggacaucu
Get sequence
Deep sequencing339 reads, 2 experiments

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
2