Mature sequence kshv-miR-K12-12-3p

Accession numberMIMAT0015238
IDkshv-miR-K12-12-3p
Previous IDskshv-miR-K12-12*;kshv-miR-K12-12
Stem-Loop kshv-mir-K12-12
Sequence
ugggggagggugcccugguuga
Get sequence
Deep sequencing reads, experiments

References

1
2
3
PMID:20566670 "Small RNA profiling reveals antisense transcription throughout the KSHV genome and novel small RNAs" Lin YT, Kincaid RP, Arasappan D, Dowd SE, Hunicke-Smith SP, Sullivan CS RNA. 16:1540-1558(2010).