Mature sequence zma-miR162-5p

Accession numberMIMAT0015147
IDzma-miR162-5p
Previous IDszma-miR162*
Stem-Loop zma-MIR162
Sequence
gggcgcagugguuuaucgauc
Get sequence
Deep sequencing6 reads, 3 experiments

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).