Mature sequence zma-miR166a-5p

Accession numberMIMAT0015146
IDzma-miR166a-5p
Previous IDszma-miR166a*
Stem-Loop zma-MIR166a
Sequence
ggaauguugucuggcucgggg
Get sequence
Deep sequencing1293 reads, 171 experiments
Database links
QuickGO function

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:14999285 "microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity" Juarez MT, Kui JS, Thomas J, Heller BA, Timmermans MC Nature. 428:84-88(2004).
3
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).