Mature sequence hsa-miR-1193

Accession numberMIMAT0015049
IDhsa-miR-1193
Stem-Loop hsa-mir-1193
Sequence
gggaugguagaccggugacgugc
Get sequence
Deep sequencing86 reads, 19 experiments
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).