Mature sequence hsa-miR-3161

Accession numberMIMAT0015035
IDhsa-miR-3161
Stem-Loop hsa-mir-3161
Sequence
cugauaagaacagaggcccagau
Get sequence
Deep sequencing110 reads, 35 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).