Mature sequence hsa-miR-3159

Accession numberMIMAT0015033
IDhsa-miR-3159
Stem-Loop hsa-mir-3159
Sequence
uaggauuacaagugucggccac
Get sequence
Deep sequencing216 reads, 52 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).