Mature sequence hsa-miR-3148

Accession numberMIMAT0015021
IDhsa-miR-3148
Stem-Loop hsa-mir-3148
Sequence
uggaaaaaacuggugugugcuu
Get sequence
Deep sequencing82 reads, 23 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).