Mature sequence hsa-miR-548v

Accession numberMIMAT0015020
IDhsa-miR-548v
Stem-Loop hsa-mir-548v
Sequence
agcuacaguuacuuuugcacca
Get sequence
Deep sequencing464 reads, 93 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).