Mature sequence hsa-miR-3147

Accession numberMIMAT0015019
IDhsa-miR-3147
Stem-Loop hsa-mir-3147
Sequence
gguugggcagugaggaggguguga
Get sequence
Deep sequencing216 reads, 16 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).