Mature sequence hsa-miR-3134

Accession numberMIMAT0015000
IDhsa-miR-3134
Stem-Loop hsa-mir-3134
Sequence
ugauggauaaaagacuacauauu
Get sequence
Deep sequencing132 reads, 48 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).