Mature sequence hsa-miR-3119

Accession numberMIMAT0014981
IDhsa-miR-3119
Stem-Loop hsa-mir-3119-1 hsa-mir-3119-2
Sequence
uggcuuuuaacuuugauggc
Get sequence
Deep sequencing96 reads, 24 experiments
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).