Mature sequence hsa-miR-3118

Accession numberMIMAT0014980
IDhsa-miR-3118
Stem-Loop hsa-mir-3118-1 hsa-mir-3118-2 hsa-mir-3118-3 hsa-mir-3118-4 hsa-mir-3118-5 hsa-mir-3118-6
Sequence
ugugacugcauuaugaaaauucu
Get sequence
Deep sequencing344 reads, 26 experiments

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).