Mature sequence hsa-miR-3116

Accession numberMIMAT0014978
IDhsa-miR-3116
Stem-Loop hsa-mir-3116-1 hsa-mir-3116-2
Sequence
ugccuggaacauaguagggacu
Get sequence
Deep sequencing303 reads, 56 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
2
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).