Mature sequence oar-miR-125b

Accession numberMIMAT0014971
IDoar-miR-125b
Stem-Loop oar-mir-125b
Sequence
ucccugagacccuaacuugug
Get sequence
Deep sequencing397869 reads, 13 experiments

References

1
PMID:20140706 "Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses" Sheng X, Song X, Yu Y, Niu L, Li S, Li H, Wei C, Liu T, Zhang L, Du L Mol Biol Rep. 38:3161-3171(2011).
2
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).