Mature sequence oar-let-7c

Accession numberMIMAT0014964
IDoar-let-7c
Stem-Loop oar-let-7c
Sequence
ugagguaguagguuguaugguu
Get sequence
Deep sequencing465011 reads, 21 experiments

References

1
PMID:20140706 "Characterization of microRNAs from sheep (Ovis aries) using computational and experimental analyses" Sheng X, Song X, Yu Y, Niu L, Li S, Li H, Wei C, Liu T, Zhang L, Du L Mol Biol Rep. 38:3161-3171(2011).
2
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).