Mature sequence mmu-miR-3096a-3p

Accession number MIMAT0014914
ID mmu-miR-3096a-3p
Previous IDs mmu-miR-3096-3p
Sequence 
uggguuaaaggauuuaccugaggcca
Get sequence
Stem-Loop mmu-mir-3096a

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).
2
PMID:20935160 "Next-generation sequencing identifies the natural killer cell microRNA transcriptome" Fehniger TA, Wylie T, Germino E, Leong JW, Magrini VJ, Koul S, Keppel CR, Schneider SE, Koboldt DC, Sullivan RP, Heinz ME, Crosby SD, Nagarajan R, Ramsingh G, Link DC, Ley TJ, Mardis ER Genome Res. 20:1590-1604(2010).
3
PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).