Mature sequence mmu-miR-669p-5p

Accession numberMIMAT0014889
IDmmu-miR-669p-5p
Previous IDsmmu-miR-669p
Stem-Loop mmu-mir-669p-1 mmu-mir-669p-2
Sequence
aguugugugugcauguucaugucu
Get sequence
Deep sequencing157688 reads, 103 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).