Mature sequence mmu-miR-3083-3p

Accession numberMIMAT0014875
IDmmu-miR-3083-3p
Previous IDsmmu-miR-3083*
Stem-Loop mmu-mir-3083
Sequence
uccgaaacauucccagccuuua
Get sequence
Deep sequencing6 reads, 6 experiments
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).