Mature sequence mmu-miR-3083-5p

Accession numberMIMAT0014874
IDmmu-miR-3083-5p
Previous IDsmmu-miR-3083
Stem-Loop mmu-mir-3083
Sequence
aggcugggaauauuucagagau
Get sequence
Deep sequencing956 reads, 37 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).