Mature sequence api-miR-3051

Accession numberMIMAT0014792
IDapi-miR-3051
Stem-Loop api-mir-3051-1 api-mir-3051-2
Sequence
aaggaacguuaaaaaccauugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).