Mature sequence hsv1-miR-H17

Accession numberMIMAT0014695
IDhsv1-miR-H17
Stem-Loop hsv1-mir-H17
Sequence
uggcgcuggggcgcgaggcgg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).