Mature sequence cqu-miR-2

Accession numberMIMAT0014412
IDcqu-miR-2
Stem-Loop cqu-mir-2
Sequence
uaucacagccagcuuugaagagc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).