Mature sequence ghr-miR827c

Accession numberMIMAT0014343
IDghr-miR827c
Stem-Loop ghr-MIR827c
Sequence
uuagaugaccaucaacaaaca
Get sequence
Deep sequencing56 reads, 2 experiments

References

1
PMID:19889219 "Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.)" Pang M, Woodward AW, Agarwal V, Guan X, Ha M, Ramachandran V, Chen X, Triplett BA, Stelly DM, Chen ZJ Genome Biol. 10:R122(2009).