Mature sequence ghr-miR827b

Accession numberMIMAT0014342
IDghr-miR827b
Stem-Loop ghr-MIR827b
Sequence
uuagaugaccaucaacaaaca
Get sequence
Deep sequencing55 reads, 1 experiments

References

1
PMID:19889219 "Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.)" Pang M, Woodward AW, Agarwal V, Guan X, Ha M, Ramachandran V, Chen X, Triplett BA, Stelly DM, Chen ZJ Genome Biol. 10:R122(2009).