Mature sequence ghr-miR827a

Accession numberMIMAT0014341
IDghr-miR827a
Stem-Loop ghr-MIR827a
Sequence
uuagaugaccaucaacaaaca
Get sequence
Deep sequencing55 reads, 1 experiments

References

1
PMID:19889219 "Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.)" Pang M, Woodward AW, Agarwal V, Guan X, Ha M, Ramachandran V, Chen X, Triplett BA, Stelly DM, Chen ZJ Genome Biol. 10:R122(2009).