Mature sequence ghr-miR479

Accession numberMIMAT0014338
IDghr-miR479
Stem-Loop ghr-MIR479
Sequence
cgugauauugguucggcucauc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19889219 "Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.)" Pang M, Woodward AW, Agarwal V, Guan X, Ha M, Ramachandran V, Chen X, Triplett BA, Stelly DM, Chen ZJ Genome Biol. 10:R122(2009).