Mature sequence aae-miR-2945-3p

Accession numberMIMAT0014316
IDaae-miR-2945-3p
Previous IDsaae-miR-2945
Stem-Loop aae-mir-2945
Sequence
ugacuagaggcagacucguuua
Get sequence
Deep sequencing323067 reads, 2 experiments

References

1