Mature sequence aae-miR-2945-5p

Accession numberMIMAT0014315
IDaae-miR-2945-5p
Previous IDsaae-miR-2945*
Stem-Loop aae-mir-2945
Sequence
agcggguccguuucuagugucaug
Get sequence
Deep sequencing158 reads, 2 experiments

References

1