Mature sequence aae-miR-286b

Accession numberMIMAT0014313
IDaae-miR-286b
Stem-Loop aae-mir-286b-1 aae-mir-286b-2
Sequence
ugacuagaccgaacacucguauccc
Get sequence
Deep sequencing6 reads, 1 experiments

References

1