Mature sequence ath-miR2933b

Accession numberMIMAT0014137
IDath-miR2933b
Stem-Loop ath-MIR2933b
Sequence
gaaaucggagaggaaauucgcc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20042113 "MicroRNA and tasiRNA diversity in mature pollen of Arabidopsis thaliana" Grant-Downton R, Le Trionnaire G, Schmid R, Rodriguez-Enriquez J, Hafidh S, Mehdi S, Twell D, Dickinson H BMC Genomics. 10:643(2009).