Mature sequence csi-miR166a-3p

Accession numberMIMAT0014090
IDcsi-miR166a-3p
Stem-Loop csi-MIR166a
Sequence
ucggaccaggcuucauuccccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).