Mature sequence ctr-miR166

Accession numberMIMAT0014071
IDctr-miR166
Stem-Loop ctr-MIR166
Sequence
ucggaccaggcuucauuccccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).