Mature sequence zma-miR1432-5p

Accession numberMIMAT0014032
IDzma-miR1432-5p
Previous IDszma-miR1432
Stem-Loop zma-MIR1432
Sequence
cucaggagagaugacaccgac
Get sequence
Deep sequencing139 reads, 4 experiments
Database links
QuickGO function

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).