Mature sequence zma-miR396e-5p

Accession numberMIMAT0014014
IDzma-miR396e-5p
Previous IDszma-miR396e
Stem-Loop zma-MIR396e
Sequence
uuccacagcuuucuugaacuu
Get sequence
Deep sequencing824 reads, 113 experiments

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).