Mature sequence zma-miR156l-5p

Accession numberMIMAT0013973
IDzma-miR156l-5p
Previous IDszma-miR156l
Stem-Loop zma-MIR156l
Sequence
ugacagaagagagugagcac
Get sequence
Deep sequencing203931 reads, 40 experiments

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).